pGL4.24-Cd36-enhancer2
(Plasmid
#138574)
-
PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17843052_17844983
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL4.24
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4411
- Total vector size (bp) 6343
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCd36 Promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1932
-
GenBank IDNC_000071.6
-
Entrez GeneCd36 (a.k.a. FAT, GPIV, Scarb3)
- Promoter Minimal promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer RVprimer3
- 3′ sequencing primer TGGCTTTACCAACAGTACCGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.24-Cd36-enhancer2 was a gift from Lora Hooper (Addgene plasmid # 138574 ; http://n2t.net/addgene:138574 ; RRID:Addgene_138574) -
For your References section:
The intestinal microbiota programs diurnal rhythms in host metabolism through histone deacetylase 3. Kuang Z, Wang Y, Li Y, Ye C, Ruhn KA, Behrendt CL, Olson EN, Hooper LV. Science. 2019 Sep 27;365(6460):1428-1434. doi: 10.1126/science.aaw3134. 10.1126/science.aaw3134 PubMed 31604271