-
PurposeFor in vivo tagging
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138585 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-MSCV-4xS1m-GFP-T2A-PU
-
Backbone manufacturerSystem Biosciences
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDANCR
-
SpeciesH. sapiens (human)
-
GenBank IDNR_024031
-
Entrez GeneDANCR (a.k.a. AGU2, ANCR, KIAA0114, SNHG13, lncRNA-ANCR)
- Promoter MSCV
-
Tag
/ Fusion Protein
- S1m tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acaaaaattcaaaattttatcga
- 3′ sequencing primer ctacacgcgagacgggtgactg
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
S1m tagged DANCR was a gift from Yin-Yuan Mo (Addgene plasmid # 138585 ; http://n2t.net/addgene:138585 ; RRID:Addgene_138585) -
For your References section:
IGF2BP2 regulates DANCR by serving as an N6-methyladenosine reader. Hu X, Peng WX, Zhou H, Jiang J, Zhou X, Huang D, Mo YY, Yang L. Cell Death Differ. 2019 Dec 5. pii: 10.1038/s41418-019-0461-z. doi: 10.1038/s41418-019-0461-z. 10.1038/s41418-019-0461-z PubMed 31804607