Skip to main content

S1m tagged DANCR
(Plasmid #138585)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138585 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDH-MSCV-4xS1m-GFP-T2A-PU
  • Backbone manufacturer
    System Biosciences
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    DANCR
  • Species
    H. sapiens (human)
  • GenBank ID
    NR_024031
  • Entrez Gene
    DANCR (a.k.a. AGU2, ANCR, KIAA0114, SNHG13, lncRNA-ANCR)
  • Promoter MSCV
  • Tag / Fusion Protein
    • S1m tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acaaaaattcaaaattttatcga
  • 3′ sequencing primer ctacacgcgagacgggtgactg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    S1m tagged DANCR was a gift from Yin-Yuan Mo (Addgene plasmid # 138585 ; http://n2t.net/addgene:138585 ; RRID:Addgene_138585)
  • For your References section:

    IGF2BP2 regulates DANCR by serving as an N6-methyladenosine reader. Hu X, Peng WX, Zhou H, Jiang J, Zhou X, Huang D, Mo YY, Yang L. Cell Death Differ. 2019 Dec 5. pii: 10.1038/s41418-019-0461-z. doi: 10.1038/s41418-019-0461-z. 10.1038/s41418-019-0461-z PubMed 31804607