pME18s-Ix_NPYLR1b
(Plasmid
#138748)
-
PurposeExpresses Ixodes scapularis NPY-like receptor 1b (NPYLR1b) in a mammalian expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepME18s
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 8269
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIxodes scapularis NPYLR1b
-
SpeciesIxodes scapularis
-
Insert Size (bp)1269
-
GenBank IDKC439541 KC439541
-
Entrez GeneLOC8025400 (a.k.a. NPYLR1B)
- Promoter SRa
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TTCTTGCAGATGTCGGATCA
- 3′ sequencing primer TTTCTCCATGTTGCAGTGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME18s-Ix_NPYLR1b was a gift from Leslie Vosshall (Addgene plasmid # 138748 ; http://n2t.net/addgene:138748 ; RRID:Addgene_138748) -
For your References section:
Functional and genetic characterization of neuropeptide Y-like receptors in Aedes aegypti. Liesch J, Bellani LL, Vosshall LB. PLoS Negl Trop Dis. 2013 Oct 10;7(10):e2486. doi: 10.1371/journal.pntd.0002486. eCollection 2013. 10.1371/journal.pntd.0002486 PubMed 24130914