pPD335 VP64-ZF43(RAAR)
(Plasmid
#138819)
-
PurposeConstitutive expression of VP64-ZF43(RAAR) under the CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPD005 pcDNA Golden Gate
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVP64-ZF43(RAAR)
-
SpeciesSynthetic
-
MutationR15A, R43A
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Leonard Lab plasmid reference number: L1381
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPD335 VP64-ZF43(RAAR) was a gift from Joshua Leonard (Addgene plasmid # 138819 ; http://n2t.net/addgene:138819 ; RRID:Addgene_138819) -
For your References section:
The COMET toolkit for composing customizable genetic programs in mammalian cells. Donahue PS, Draut JW, Muldoon JJ, Edelstein HI, Bagheri N, Leonard JN. Nat Commun. 2020 Feb 7;11(1):779. doi: 10.1038/s41467-019-14147-5. 10.1038/s41467-019-14147-5 PubMed 32034124