Skip to main content

pPD138 ZF43x10-Spaced-Mid_EYFP
(Plasmid #138888)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138888 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPD032 Reporter Template v1 (Mid Spaced)
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZF43x10-Spaced-Mid
  • Species
    Synthetic
  • Promoter ZF43x10-Spaced-Mid

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CGACACGGAAATGTTGAATAC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Leonard Lab plasmid reference number: L1416

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPD138 ZF43x10-Spaced-Mid_EYFP was a gift from Joshua Leonard (Addgene plasmid # 138888 ; http://n2t.net/addgene:138888 ; RRID:Addgene_138888)