pPD295 ZF43x11-Compact_EYFP
(Plasmid
#138906)
-
PurposeEYFP reporter vector for the ZF43x11-Compact promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPD152 Reporter Template v2
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZF43x11-Compact
-
SpeciesSynthetic
- Promoter ZF43x11-Compact
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGACACGGAAATGTTGAATAC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Leonard Lab plasmid reference number: L1555
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPD295 ZF43x11-Compact_EYFP was a gift from Joshua Leonard (Addgene plasmid # 138906 ; http://n2t.net/addgene:138906 ; RRID:Addgene_138906)