pCFD3-dUG-D01
(Plasmid
#138962)
-
PurposeUsed in the editing of Drosophila kkv
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCFD3-dUG
-
Vector typeCRISPR ; to synthesize gRNA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameD01 oligo
-
gRNA/shRNA sequenceGTCGTTTCTCACTCTCATCAAACTGTTT
-
SpeciesD. melanogaster (fly)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer ccagactcagttcg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/718841v3 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD3-dUG-D01 was a gift from Paul Adler (Addgene plasmid # 138962 ; http://n2t.net/addgene:138962 ; RRID:Addgene_138962) -
For your References section:
The localization of chitin synthase mediates the patterned deposition of chitin in developing Drosophila bristles. Adler PN. bioRxiv 2020 10.1101/718841