Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1(+)-MC38-TCRA-30-picky_sticky
(Plasmid #138983)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138983 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    GenScript
  • Backbone size w/o insert (bp) 5357
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TCRA
  • Alt name
    picky sticky alpha
  • Alt name
    30_TRA_CAIDPYNQGKLIF_TGTGCTATAGATCCTTATAACCAGGGGAAGCTTATCTTT
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    815
  • Entrez Gene
    Tcra (a.k.a. Tcralpha)
  • Promoter CMV and T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)-MC38-TCRA-30-picky_sticky was a gift from Jeff Hammerbacher (Addgene plasmid # 138983 ; http://n2t.net/addgene:138983 ; RRID:Addgene_138983)
  • For your References section:

    Discovering tumor-reactive T-cell receptors through single-cell sequencing of tumor-infiltrating lymphocytes. Gottschalk E, Aksoy BA, Aksoy P, Swiderska-syn M, Mart C, Macpherson L, Romeo M, Smith A, Knochelmann H, Paulos C, Timmers C, Wrangle J, Rubinstein MP, Hammerbacher J. bioRxiv 2021.11.30.470597 10.1101/2021.11.30.470597