Skip to main content

pSBBi-RP CCS1(Δ304-316)
(Plasmid #139163)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139163 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBBi-RP
  • Total vector size (bp) 7554
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    caffeine synthase 1 [Coffea arabica] CCS-CTS region deletion
  • Alt name
    CCS1 CCS-CTS deletion
  • Alt name
    CCS1(delC13)
  • Alt name
    CCS1(Δ304-319)
  • Species
    Coffee arabica
  • Insert Size (bp)
    1113
  • Mutation
    deleted amino acids 304-319
  • GenBank ID
    Q8H0D3.1
  • Promoter EF1α

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SB-transposon with constitutive bi-directional promoter. One side contains Coffea arabica caffeine synthase 1 with CCS-CTS deletion (Δ304-316) which has been reported* to affect enzyme selectivity; the other side contains RFP and puromycin resistance genes.

*CCS-CTS deletion reference: Mizuno, K., et al. Z Naturforsch C J Biosci. Mar-Apr 2010;65(3-4):257-65. doi: 10.1515/znc-2010-3-414.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBBi-RP CCS1(Δ304-316) was a gift from Neal Devaraj (Addgene plasmid # 139163 ; http://n2t.net/addgene:139163 ; RRID:Addgene_139163)