pSBBi-GB CaXMT1
(Plasmid
#139168)
-
PurposeSB-transposon with constitutive bi-directional promoter. One side contains Coffea arabica xanthosine methyltransferase 1 (CaXMT1); the other side contains GFP and blasticidin resistance genes.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBBi-GB
- Total vector size (bp) 7371
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name7-methylxanthosine synthase 1 [Coffea arabica]
-
Alt nameXMT1
-
Alt nameCaXMT1
-
SpeciesCoffee arabica
-
Insert Size (bp)1119
-
GenBank IDXP_027086771.1
- Promoter EF1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SB-transposon with constitutive bi-directional promoter. One side contains Coffea arabica 7-methylxanthosine synthase 1; the other side contains GFP and blasticidin resistance genes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBBi-GB CaXMT1 was a gift from Neal Devaraj (Addgene plasmid # 139168 ; http://n2t.net/addgene:139168 ; RRID:Addgene_139168)