pSBBi-GB TCS2
(Plasmid
#139171)
-
PurposeSB-transposon with constitutive bi-directional promoter. One side contains tea caffeine synthase 1 (TCS2) from Camellia sinensis; the other side contains GFP and blasticidin resistance genes.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBBi-GB
- Total vector size (bp) 7350
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameprobable caffeine synthase 2 [Camellia sinensis]
-
Alt nameTCS2
-
Alt nameTea caffeine synthase 2
-
Alt name7-methylxanthosine synthase
-
SpeciesCoffee arabica
-
Insert Size (bp)1095
-
GenBank IDQ68CM3.1
- Promoter EF1α
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SB-transposon with constitutive bi-directional promoter. One side contains Camellia sinensis probable caffeine synthase 2 (TCS2); the other side contains GFP and blasticidin resistance genes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBBi-GB TCS2 was a gift from Neal Devaraj (Addgene plasmid # 139171 ; http://n2t.net/addgene:139171 ; RRID:Addgene_139171)