Skip to main content

pSBTet(-ΔrtTA)-GB dTomato-P2A-CaMXMT
(Plasmid #139176)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139176 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBTet-GB
  • Total vector size (bp) 7575
  • Modifications to backbone
    -ΔrtTA
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CaMXMT
  • Species
    Coffea arabica
  • Insert Size (bp)
    1902
  • Mutation
    P131T on dTomato (Please see depositor comments)
  • GenBank ID
    XP_027086104
  • Promoter tight TRE-controlled CMV
  • Tag / Fusion Protein
    • dTomato-P2A (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCCTACCCTCGAAAGGC
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SB-transposon with inducible SfiI cloning site containing dTomato-P2A-CaMXMT and constitutive expression of GFP and blasticidin resistance gene. Inducible gene expression can be stimulated by co-expression of TetOFF (e.g. tTA-advanced, TetRVP64).
Found mutation P131T on dTomato, depositor confirms this is not a concern

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBTet(-ΔrtTA)-GB dTomato-P2A-CaMXMT was a gift from Neal Devaraj (Addgene plasmid # 139176 ; http://n2t.net/addgene:139176 ; RRID:Addgene_139176)