pSBTet(-ΔrtTA)-GB dTomato-P2A-CaMXMT
(Plasmid
#139176)
-
PurposeSB-transposon with inducible expression of dTomato and Coffea arabica monomethylxathine methyltransferase via P2A self-cleaving linker in a Tet-inducible pSBTRE(-ΔrtTA)-GB backbone.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBTet-GB
- Total vector size (bp) 7575
-
Modifications to backbone-ΔrtTA
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCaMXMT
-
SpeciesCoffea arabica
-
Insert Size (bp)1902
-
MutationP131T on dTomato (Please see depositor comments)
-
GenBank IDXP_027086104
- Promoter tight TRE-controlled CMV
-
Tag
/ Fusion Protein
- dTomato-P2A (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCCTACCCTCGAAAGGC
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SB-transposon with inducible SfiI cloning site containing dTomato-P2A-CaMXMT and constitutive expression of GFP and blasticidin resistance gene. Inducible gene expression can be stimulated by co-expression of TetOFF (e.g. tTA-advanced, TetRVP64).
Found mutation P131T on dTomato, depositor confirms this is not a concern
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBTet(-ΔrtTA)-GB dTomato-P2A-CaMXMT was a gift from Neal Devaraj (Addgene plasmid # 139176 ; http://n2t.net/addgene:139176 ; RRID:Addgene_139176)