pSBBi-Pur GFP-TM
(Plasmid
#139185)
-
PurposeSB-transposon with constitutive bi-directional promoter. One side contains transmembrane-anchored GFP; the other side contains the puromycin resistance gene.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBBi-Pur
- Backbone size w/o insert (bp) 5857
- Total vector size (bp) 6618
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-TM
-
Alt namesurface GFP
-
Alt nameEGFP Ligand
-
SpeciesAequorea victoria
-
Insert Size (bp)933
-
Mutationfused to membrane anchor
-
GenBank ID
- Promoter EF1α
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SB-transposon with constitutive bi-directional promoter. One side contains surface-anchored EGFP; the other side contains puromycin resistance .
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBBi-Pur GFP-TM was a gift from Neal Devaraj (Addgene plasmid # 139185 ; http://n2t.net/addgene:139185 ; RRID:Addgene_139185)