Smp_200150
(Plasmid
#139360)
-
PurposepGEM T-easy Vector with S.mansoni gene Smp_200150 inserted
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEM T-easy
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3015
- Total vector size (bp) 3262
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSmp_200150
-
SpeciesS. mansoni
-
Insert Size (bp)247
- Promoter T7/SP6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ACGATGTAGTCAGTTTGTTTGGT
- 3′ sequencing primer TAACTTGTGAGTGCGTGCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Smp_200150 was a gift from John D. Chan (Addgene plasmid # 139360 ; http://n2t.net/addgene:139360 ; RRID:Addgene_139360) -
For your References section:
Schistosoma mansoni alter transcription of immunomodulatory gene products following in vivo praziquantel exposure. McCusker P, Rohr CM, Chan JD. PLoS Negl Trop Dis. 2021 Mar 3;15(3):e0009200. doi: 10.1371/journal.pntd.0009200. eCollection 2021 Mar. 10.1371/journal.pntd.0009200 PubMed 33657133