pMT451
(Plasmid
#139391)
-
PurposeBile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOT Gate 4), pNBU1 backbone, AmpR, ErmR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139391 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNBU1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOT Gate 4)
- Promoter BA inducible promoters
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aacgcactgagaagccctta
- 3′ sequencing primer tgagcaacaaggaatccaaca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT451 was a gift from Christopher Voigt (Addgene plasmid # 139391 ; http://n2t.net/addgene:139391 ; RRID:Addgene_139391) -
For your References section:
Genetic circuit design automation for the gut resident species Bacteroides thetaiotaomicron. Taketani M, Zhang J, Zhang S, Triassi AJ, Huang YJ, Griffith LG, Voigt CA. Nat Biotechnol. 2020 Aug;38(8):962-969. doi: 10.1038/s41587-020-0468-5. Epub 2020 Mar 30. 10.1038/s41587-020-0468-5 PubMed 32231334