p_SNIPR_sensor_GFP
(Plasmid
#139463)
-
PurposeT7 RNAP-driven expression of SNIPR RNA with a GFP-ASV reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCOLAduet
- Backbone size w/o insert (bp) 3224
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNIPR_GFP
-
SpeciesOther
-
Insert Size (bp)876
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTTACTGGTTTCACATTCACCACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SNIPR regulating GFPmut3b with an ASV degradation tag
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p_SNIPR_sensor_GFP was a gift from Alexander Green (Addgene plasmid # 139463 ; http://n2t.net/addgene:139463 ; RRID:Addgene_139463) -
For your References section:
Precise and Programmable Detection of Mutations Using Ultraspecific Riboregulators. Hong F, Ma D, Wu K, Mina LA, Luiten RC, Liu Y, Yan H, Green AA. Cell. 2020 Feb 25. pii: S0092-8674(20)30155-0. doi: 10.1016/j.cell.2020.02.011. 10.1016/j.cell.2020.02.011 PubMed 32109416