pSP266
(Plasmid
#139488)
-
PurposeInsertion of the pCTT1 promoter and 24 PP7 stem loops in the GLT1 locus using HIS marker in S. cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHIS
- Backbone size w/o insert (bp) 3950
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepCTT1 24xPP7sl
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)4509
-
MutationWT
- Promoter pCTT1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TGGTCGCTATACTGCTGTCG
- 3′ sequencing primer T7 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSP266 was a gift from Serge Pelet (Addgene plasmid # 139488 ; http://n2t.net/addgene:139488 ; RRID:Addgene_139488) -
For your References section:
Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors. Wosika V, Pelet S. Nat Commun. 2020 Jun 23;11(1):3171. doi: 10.1038/s41467-020-16943-w. 10.1038/s41467-020-16943-w PubMed 32576833