Skip to main content

pVW293
(Plasmid #139490)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139490 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHIS
  • Backbone size w/o insert (bp) 3950
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pHSP12 24xPP7sl
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    4509
  • Mutation
    WT
  • Promoter pHSP12

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site SacII (unknown if destroyed)
  • 5′ sequencing primer TGGTCGCTATACTGCTGTCG
  • 3′ sequencing primer T7
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVW293 was a gift from Serge Pelet (Addgene plasmid # 139490)
  • For your References section:

    Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors. Wosika V, Pelet S. Nat Commun. 2020 Jun 23;11(1):3171. doi: 10.1038/s41467-020-16943-w. 10.1038/s41467-020-16943-w PubMed 32576833