Skip to main content

pVW294
(Plasmid #139491)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139491 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHIS
  • Backbone size w/o insert (bp) 3950
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pGRE2 24xPP7sl
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    4509
  • Mutation
    WT
  • Promoter pGRE2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TGGTCGCTATACTGCTGTCG
  • 3′ sequencing primer T7
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's lab has found that this plasmid encodes 22 PP7 stem loops rather than the reported 24. Depositor noted that PP7 stem loop repeat region is prone to losing repeats over time and recommends verifying repeats by whole plasmid sequencing to avoid further loss of repeats.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVW294 was a gift from Serge Pelet (Addgene plasmid # 139491 ; http://n2t.net/addgene:139491 ; RRID:Addgene_139491)
  • For your References section:

    Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors. Wosika V, Pelet S. Nat Commun. 2020 Jun 23;11(1):3171. doi: 10.1038/s41467-020-16943-w. 10.1038/s41467-020-16943-w PubMed 32576833