pSP571
(Plasmid
#139498)
-
PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS423II
- Backbone size w/o insert (bp) 5726
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepGPD Cas9 / sgRNA (STL162)
-
gRNA/shRNA sequenceATAAGCAGAACCAGTCACTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)4413
-
MutationWT
- Promoter pGPD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpHI (unknown if destroyed)
- 3′ cloning site SacII (unknown if destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer T3 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byModified from Addgene #35464
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSP571 was a gift from Serge Pelet (Addgene plasmid # 139498 ; http://n2t.net/addgene:139498 ; RRID:Addgene_139498) -
For your References section:
Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors. Wosika V, Pelet S. Nat Commun. 2020 Jun 23;11(1):3171. doi: 10.1038/s41467-020-16943-w. 10.1038/s41467-020-16943-w PubMed 32576833