pTF-FLPe
              
              
                (Plasmid
                
                #139672)
              
            
            
            
          - 
            PurposeExpression cassette for FLPe recombinase in T-DNA vector
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepTF101
 - Backbone size w/o insert (bp) 9189
 - Total vector size (bp) 13160
 - 
              Vector typePlant Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Spectinomycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameFLPe recombinase
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)1269
 - Promoter Maize Ubiquitin
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer GATGCTCACCCTGTTGTTTGGTGT
 - 3′ sequencing primer AACGTGGGTAGCACCAAAAC (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            Article Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pTF-FLPe was a gift from James Birchler (Addgene plasmid # 139672 ; http://n2t.net/addgene:139672 ; RRID:Addgene_139672) - 
                
For your References section:
Site-specific recombinase genome engineering toolkit in maize. Cody JP, Graham ND, Zhao C, Swyers NC, Birchler JA. Plant Direct. 2020 Mar 9;4(3):e00209. doi: 10.1002/pld3.209. eCollection 2020 Mar. 10.1002/pld3.209 PubMed 32166212