TBXTA-c026
(Plasmid
#139763)
-
PurposeProtein expression/GST pull-down
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGTVL2 (GenBank: JF522100.1)
-
Backbone manufacturerSGC
- Backbone size w/o insert (bp) 5993
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTBXT, Full-length, WT
-
Alt nameBrachyury
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1341
-
MutationContains only amino acids S2- M435
-
Entrez GeneTBXT (a.k.a. SAVA, T, TFT)
- Promoter T7
-
Tag
/ Fusion Protein
- His6-GST-TEV (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pGEX5: GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer T7R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
S2- M435 : Codon-optimized for E. coli expression
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TBXTA-c026 was a gift from Opher Gileadi (Addgene plasmid # 139763 ; http://n2t.net/addgene:139763 ; RRID:Addgene_139763)