pAC8_MF-p10-mCh PH-mCh (VE5625)
(Plasmid
#139769)
-
PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an mCherry cDNA under each promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAcPAK8
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7175
- Total vector size (bp) 7887
-
Modifications to backboneThe pAC8_MF-p10-mCh PH-mCh (VE5625) is a derivative of pBAcPAK8 (Clontech) for generation of recombinant baculoviruses by homologous recombination. It contains the Multibac dual expression cassette composed of two divergent baculovirus late promoters (PH and p10), each followed by a multiple cloning site (MSC1 and MSC2) and a transcription termination signal (SV40 pA and HSCV pA). It also possess a multiplication module for insertion of additional expression cassettes and a loxP site for Cre-mediated fusion with a donor plasmid containing additional expression cassettes. An mCherry gene is cloned in each MCS: One has to be replaced by the GOI; The protein expressed from the remaining mCherry gene will be used to monitor infection. Insertion of DNA sequence is typically performed in the two multiple cloning sites (MCS1 with BamHI/XbaI under the PH promoter and MCS2 with XhoI/NheI under the p10 promoter) by restriction/ligation or homology based cloning (SLIC, Infusion or Gibson). Dual expression cassettes can also be assembled directly using a 4 fragment reaction where the plasmid backbone is combined with the promoter module and the cDNAs encoding the two target genes.
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry fluorescent protein
-
Insert Size (bp)711
- Promoter PH or p10
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI or XhoI (unknown if destroyed)
- 3′ cloning site XbaI or NheI (unknown if destroyed)
- 5′ sequencing primer ACCATCTCGCAAATAAATAA or CCCAACACAATATATTATAG
- 3′ sequencing primer TGGTATGGCTGATTATGATC or CACCCGTGCGTTTTATTCTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC8_MF-p10-mCh PH-mCh (VE5625) was a gift from Arnaud Poterszman (Addgene plasmid # 139769 ; http://n2t.net/addgene:139769 ; RRID:Addgene_139769) -
For your References section:
HR-Bac, a toolbox based on homologous recombination for expression, screening and production of multiprotein complexes using the baculovirus expression system. Kolesnikova O, Zachayus A, Pichard S, Osz J, Rochel N, Rossolillo P, Kolb-Cheynel I, Troffer-Charlier N, Compe E, Bensaude O, Berger I, Poterszman A. Sci Rep. 2022 Feb 7;12(1):2030. doi: 10.1038/s41598-021-04715-5. 10.1038/s41598-021-04715-5 PubMed 35132103