pFUW-tetO-NFE2
              
              
                (Plasmid
                
                #139825)
              
            
            
            
          - 
            Purposedoxycycline-inducible expression of Human NFE2 in mammalian cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepFUW-tetO
- 
              Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameNFE2
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)1122
- 
                    GenBank IDNM_006163.2
- 
                        Entrez GeneNFE2 (a.k.a. NF-E2, p45)
- Promoter TRE-mCMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer TCCACGCTGTTTTGACCTCC (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pFUW-tetO-NFE2 was a gift from Filipe Pereira (Addgene plasmid # 139825 ; http://n2t.net/addgene:139825 ; RRID:Addgene_139825)
- 
                For your References section: Direct reprogramming of fibroblasts into antigen-presenting dendritic cells. Rosa FF, Pires CF, Kurochkin I, Ferreira AG, Gomes AM, Palma LG, Shaiv K, Solanas L, Azenha C, Papatsenko D, Schulz O, Reis e Sousa C, Pereira CF. Sci Immunol. 2018 Dec 7;3(30). pii: 3/30/eaau4292. doi: 10.1126/sciimmunol.aau4292. 10.1126/sciimmunol.aau4292 PubMed 30530727
