pSZT025
(Plasmid
#140033)
-
PurposeKO of PCC 7002 fadD gene/expresses codon-optimized 'tesA gene from E. coli from inducible cLac143 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 6707
-
Modifications to backbonePCC 7002 fadD up and downstream sequences for homologous recombination; Kanamycin resistance cassette; cLac143 promoter and LacI gene under pMB2 promoter control
-
Vector typeBacterial Expression
-
Selectable markersAmpicillin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTruncated thioesterase gene
-
Alt name'tesA
-
SpeciesEscherichia coli
-
Insert Size (bp)549
- Promoter cLac143
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGATGGGTGAAATCTGGTTTTAAAGTAGG
- 3′ sequencing primer T7 terminator (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/684944v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSZT025 was a gift from Peter Nixon (Addgene plasmid # 140033 ; http://n2t.net/addgene:140033 ; RRID:Addgene_140033) -
For your References section:
Newly discovered Synechococcus sp. PCC 11901 is a robust cyanobacterial strain for high biomass production. Wlodarczyk A, Selao TT, Norling B, Nixon PJ. Commun Biol. 2020 May 7;3(1):215. doi: 10.1038/s42003-020-0910-8. 10.1038/s42003-020-0910-8 PubMed 32382027