pZJQIBEBT003
(Plasmid
#140053)
-
PurposeThe pZJQIBEBT003 plasmid contains the coding sequence of eMutS-L157C-G233C gene which has the ability of error removal in the gene synthesis process.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET21c
- Total vector size (bp) 9170
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeMutS-L157C-G233C-CBM-EGFP
-
SpeciesEscherichia coli
-
Insert Size (bp)3783
-
MutationL157C, G233C
- Promoter T7
-
Tag
/ Fusion Protein
- His-Tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer eMutS-F:ATGAGTGCAATAGAAAATTTCG
- 3′ sequencing primer eMutS-R:CACCAGGCTCTTCAAGCGATAAATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZJQIBEBT003 was a gift from Jia Zhang (Addgene plasmid # 140053 ; http://n2t.net/addgene:140053 ; RRID:Addgene_140053) -
For your References section:
Efficient and Low-Cost Error Removal in DNA Synthesis by a High-Durability MutS. Zhang J, Wang Y, Chai B, Wang J, Li L, Liu M, Zhao G, Yao L, Gao X, Yin Y, Xu J. ACS Synth Biol. 2020 Apr 17;9(4):940-952. doi: 10.1021/acssynbio.0c00079. Epub 2020 Mar 13. 10.1021/acssynbio.0c00079 PubMed 32135061