pKM493
(Plasmid #140191)

• Purpose: ORBIT integrating plasmid for C-terminal tagging with cleavable EGFP.
• Depositing Lab: Kenan Murphy
• Publication: Murphy et al MBio. 2018 Dec 11;9(6). pii: mBio.01467-18. doi: 10.1128/mBio.01467-18.

Backbone

• Vector backbone: pKM488
• Backbone manufacturer: Kenan Murphy
• Backbone size w/o insert (bp): 3486
• Total vector size (bp): 4247
• Modifications to backbone: Insertion of TEV-Flag-Gly4-eGFP
• Vector type: Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: TEV-Flag-Gly4-eGFP
• Species: Synthetic
• Insert Size (bp): 793
• Promoter: PGroEL
• Tag / Fusion Protein:
  • Flag + eGFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GAGGAACTGGCGCAGTTCCTCTGG
• 3′ sequencing primer: CCTGGTATCTTTATAGTCCTGTCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pKM493 is an ORBIT integrating vector used to tag C-terminus of chromosomal genes with Flag-GFP.