pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
(Plasmid #140193)

• Purpose: Chromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197.

Backbone

• Vector backbone: pGem
• Backbone size w/o insert (bp): 3033
• Total vector size (bp): 12547
• Vector type: CRISPR, Synthetic Biology ; Fungal genome integration.
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dLbCas12a-VPR
• Alt name: dLbCpf1-VPR
• Species: Synthetic; Lachnospiraceae bacterium
• Mutation: D832A DNAse deactivated
• Promoter: PgpdA
• Tag / Fusion Protein:
  • VPR (VP64-p65-Rta), NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCAGTCCAACATTTGTTGC

Gene/Insert 2

• Gene/Insert name: Bar
• Alt name: Glufosinate/basta-resistance
• Species: Streptomyces hygroscopicus
• Insert Size (bp): 552
• Promoter: PtrpC

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCGACAGAAGATGATATTGAAGGAG

Gene/Insert 3

• Gene/Insert name: Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
• Species: Aspergillus nidulans
• Insert Size (bp): 1040

Gene/Insert 4

• Gene/Insert name: Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
• Species: Aspergillus nidulans
• Insert Size (bp): 1033

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To be linerised with NotI for homologous recombination in Aspergillus nidulans nkuA deficient strains, selecting with glufosinate/Basta. It can also be used for random genome integration in other fungal strains.