-
PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_NG-pmCDA1(R187W)-UGI-UGI-P2A-EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCMV
-
Backbone manufacturerpCMV-ABEmax-P2A-EGFP (Addgene #112101)
- Backbone size w/o insert (bp) 3400
- Total vector size (bp) 10308
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSPACE_NG
-
Alt namebpNLS-TadA*(V82G)-nCas9_NG-bpNLS-pmCDA1(R187W)-UGI-UGI-P2A-EGFP
-
SpeciesE. coli, S. pyogenes, P. marinus
-
Insert Size (bp)6943
-
MutationV82G in TadA*, NG mutations in SpCas9, D10A in SpCas9_NG, R187W in pmCDA1
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene #131313, #131300, #125615
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SPACE-NG (pRZ5150) was a gift from Keith Joung (Addgene plasmid # 140244 ; http://n2t.net/addgene:140244 ; RRID:Addgene_140244) -
For your References section:
A dual-deaminase CRISPR base editor enables concurrent adenine and cytosine editing. Grunewald J, Zhou R, Lareau CA, Garcia SP, Iyer S, Miller BR, Langner LM, Hsu JY, Aryee MJ, Joung JK. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0535-y. doi: 10.1038/s41587-020-0535-y. 10.1038/s41587-020-0535-y PubMed 32483364