SECURE BE4max(R33A) (pBM608)
(Plasmid
#140251)
-
PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9-UGI-UGI-P2A-EGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCMV
-
Backbone manufacturerpCMV-ABEmax-P2A-EGFP (Addgene #112101)
- Backbone size w/o insert (bp) 3400
- Total vector size (bp) 9753
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBE4max(R33A)
-
Alt namebpNLS-rAPOBEC1(R33A)-nCas9-UGI-UGI-bpNLS-P2A-EGFP
-
SpeciesR. norvegicus (rat); S. pyogenes
-
Insert Size (bp)6392
-
MutationR33A in rAPOBEC1, D10A in Cas9
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene #112093
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SECURE BE4max(R33A) (pBM608) was a gift from Keith Joung (Addgene plasmid # 140251 ; http://n2t.net/addgene:140251 ; RRID:Addgene_140251) -
For your References section:
CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells. Kurt IC, Zhou R, Iyer S, Garcia SP, Miller BR, Langner LM, Grunewald J, Joung JK. Nat Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi: 10.1038/s41587-020-0609-x. 10.1038/s41587-020-0609-x PubMed 32690971