pEF-APEX2-NLS
(Plasmid
#140281)
-
PurposeExpression of APEX2-NLS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEF1
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAPEX2-NLS
-
Alt nameAPEX2-NLS
-
Insert Size (bp)2520
-
GenBank ID
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tggcacttgatgtaattctccttgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-APEX2-NLS was a gift from Yusuke Miyanari (Addgene plasmid # 140281 ; http://n2t.net/addgene:140281 ; RRID:Addgene_140281) -
For your References section:
Genomic Profiling by ALaP-Seq Reveals Transcriptional Regulation by PML Bodies through DNMT3A Exclusion. Kurihara M, Kato K, Sanbo C, Shigenobu S, Ohkawa Y, Fuchigami T, Miyanari Y. Mol Cell. 2020 May 7;78(3):493-505.e8. doi: 10.1016/j.molcel.2020.04.004. Epub 2020 Apr 29. 10.1016/j.molcel.2020.04.004 PubMed 32353257