pCFL-mPML-3KRmut-iB
(Plasmid
#140287)
-
PurposeExpression of mouse PML KR mutant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140287 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePML
-
Alt namePML
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2520
-
GenBank IDNM_008884
-
Entrez GenePml (a.k.a. 1200009E24Rik, Trim19)
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
- 3′ sequencing primer CTTCGGCCAGTAACGTTAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFL-mPML-3KRmut-iB was a gift from Yusuke Miyanari (Addgene plasmid # 140287 ; http://n2t.net/addgene:140287 ; RRID:Addgene_140287) -
For your References section:
Genomic Profiling by ALaP-Seq Reveals Transcriptional Regulation by PML Bodies through DNMT3A Exclusion. Kurihara M, Kato K, Sanbo C, Shigenobu S, Ohkawa Y, Fuchigami T, Miyanari Y. Mol Cell. 2020 May 7;78(3):493-505.e8. doi: 10.1016/j.molcel.2020.04.004. Epub 2020 Apr 29. 10.1016/j.molcel.2020.04.004 PubMed 32353257