pKLV-XAF1
              
              
                (Plasmid
                
                #140290)
              
            
            
            
          - 
            PurposeTo knockout murine XAF1 gene by CRISPR-Cas9 system
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140290 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepBluescript
 - 
              Vector typeLentiviral
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameXAF1 sgRNA
 - 
                    gRNA/shRNA sequenceGGGCTGACTTCCAAGTGTGC
 - 
                    SpeciesM. musculus (mouse)
 - 
                        Entrez GeneXaf1 (a.k.a. Fbox39)
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer n/a (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pKLV-XAF1 was a gift from Adriano Aguzzi (Addgene plasmid # 140290 ; http://n2t.net/addgene:140290 ; RRID:Addgene_140290)