Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #140292)


Item Catalog # Description Quantity Price (USD)
Plasmid 140292 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 9748
  • Total vector size (bp) 10467
  • Modifications to backbone
    6xHis tag insert
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    Kit ligand a
  • Alt name
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
  • Entrez Gene
    kitlga (a.k.a. kitla)
  • Tag / Fusion Protein
    • 6x His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CCGGATTATTCATACCGTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAc-­His-­zfKitlga was a gift from Petr Bartunek (Addgene plasmid # 140292 ; ; RRID:Addgene_140292)
  • For your References section:

    Zebrafish Kit ligands cooperate with erythropoietin to promote erythroid cell expansion. Oltova J, Svoboda O, Machonova O, Svatonova P, Traver D, Kolar M, Bartunek P. Blood Adv. 2020 Dec 8;4(23):5915-5924. doi: 10.1182/bloodadvances.2020001700. 10.1182/bloodadvances.2020001700 PubMed 33259600