pAc-His-zfKitlgb
(Plasmid
#140293)
-
PurposeExpress soluble His-tagged zebrafish Kitlgb in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAcGP-67A
- Backbone size w/o insert (bp) 9748
- Total vector size (bp) 10472
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameKitlgb
-
Alt nameKit ligand b
-
Alt nameSCFb
-
Alt namestem cell factor b
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)480
-
Entrez Genekitlgb (a.k.a. kitlb)
-
Tag
/ Fusion Protein
- 6x His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCGGATTATTCATACCGTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a V117I mutation in the insert. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc-His-zfKitlgb was a gift from Petr Bartunek (Addgene plasmid # 140293 ; http://n2t.net/addgene:140293 ; RRID:Addgene_140293) -
For your References section:
Zebrafish Kit ligands cooperate with erythropoietin to promote erythroid cell expansion. Oltova J, Svoboda O, Machonova O, Svatonova P, Traver D, Kolar M, Bartunek P. Blood Adv. 2020 Dec 8;4(23):5915-5924. doi: 10.1182/bloodadvances.2020001700. 10.1182/bloodadvances.2020001700 PubMed 33259600