pN_UBQ10/mApple
(Plasmid
#140405)
-
PurposemApple expression regulated by the A. thaliana UBQ10 promoter, co-expressed nourseothricin acetyl transferase selectable marker (nat)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepN_35S/mApple
- Backbone size w/o insert (bp) 8202
- Total vector size (bp) 9577
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersNourseothricin/streptothricin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemApple
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter AtUBQ10
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGTTTCTAGTTTGTGCGATCG
- 3′ sequencing primer ATATGCTCAACACATGAGCGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymApple was amplified from mApple-pBAD, a gift from Michael Davidson & Nathan Shaner & Roger Tsien (Addgene plasmid # 54536 ; http://n2t.net/addgene:54536 ; RRID:Addgene_54536).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN_UBQ10/mApple was a gift from Mathias Pribil (Addgene plasmid # 140405 ; http://n2t.net/addgene:140405 ; RRID:Addgene_140405)