GS1.1/CURT1A
(Plasmid #140411)

• Purpose: mApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)
• Depositing Lab: Mathias Pribil
• Publication: Quantitative comparison of specialised leaf promoters (unpublished)

Backbone

• Vector backbone: pB2GW7
• Backbone manufacturer: https://gateway.psb.ugent.be
• Backbone size w/o insert (bp): 8179
• Modifications to backbone: BASTA resistance marker (bar) replaced with nourseothricin resistance marker (nat).
• Vector type: Plant Expression, Synthetic Biology
• Selectable markers: Nourseothricin/streptothricin

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: mApple
• Species: Synthetic
• Insert Size (bp): 711
• Promoter: Cauliflower mosaic virus 35S

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCGGATTCCATTGCCCAGCTAT
• 3′ sequencing primer: ATATGCTCAACACATGAGCGA

Gene/Insert 2

• Gene/Insert name: mCitrine
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: A. thaliana CURT1A

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTGGTCGAGCTGGACGGCGACG
• 3′ sequencing primer: CACGAACTCCAGCAGGACCATG

Resource Information

• Supplemental Documents:
  • GS1_CURT1A.gb
• A portion of this plasmid was derived from a plasmid made by: mApple was amplified from mApple-pBAD, a gift from Michael Davidson & Nathan Shaner & Roger Tsien (Addgene plasmid # 54536 ; http://n2t.net/addgene:54536 ; RRID:Addgene_54536). The mCitrine coding sequence was originally obtained from the pET mCitrine LIC cloning vector (a gift from Scott Gradia (Addgene plasmid # 29771)).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry