GS1.1/CURT1C
(Plasmid
#140413)
-
PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140413 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepB2GW7
-
Backbone manufacturerhttps://gateway.psb.ugent.be
- Backbone size w/o insert (bp) 8179
-
Modifications to backboneBASTA resistance marker (bar) replaced with nourseothricin resistance marker (nat).
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersNourseothricin/streptothricin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemApple
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter Cauliflower mosaic virus 35S
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCGGATTCCATTGCCCAGCTAT
- 3′ sequencing primer ATATGCTCAACACATGAGCGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCitrine
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter A. thaliana CURT1C
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGGTCGAGCTGGACGGCGACG
- 3′ sequencing primer CACGAACTCCAGCAGGACCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymApple was amplified from mApple-pBAD, a gift from Michael Davidson & Nathan Shaner & Roger Tsien (Addgene plasmid # 54536 ; http://n2t.net/addgene:54536 ; RRID:Addgene_54536). The mCitrine coding sequence was originally obtained from the pET mCitrine LIC cloning vector (a gift from Scott Gradia (Addgene plasmid # 29771)).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GS1.1/CURT1C was a gift from Mathias Pribil (Addgene plasmid # 140413 ; http://n2t.net/addgene:140413 ; RRID:Addgene_140413)