- 
            PurposeFor sgRNA expression in monocotyledons protoplasts
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepMOD_C0000
- 
              Backbone manufacturerDaniel Voytas (Addgene plasmid # 91081)
- 
              Vector typePlant Expression, CRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameTaU3-sgRNA
- 
                    gRNA/shRNA sequencescaffold: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
- 
                    SpeciesStreptococcus pyogene
- Promoter TaU3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            
            
            Addgene Notes
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid may form dimers or multimers. Please see Addgene's Diagnostic Digest for reference. We recommend screening multiple colonies.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: QPM-sgR (pTaU3) was a gift from Caixia Gao (Addgene plasmid # 140448 ; http://n2t.net/addgene:140448 ; RRID:Addgene_140448)
- 
                For your References section: Prime genome editing in rice and wheat. Lin Q, Zong Y, Xue C, Wang S, Jin S, Zhu Z, Wang Y, Anzalone AV, Raguram A, Doman JL, Liu DR, Gao C. Nat Biotechnol. 2020 May;38(5):582-585. doi: 10.1038/s41587-020-0455-x. Epub 2020 Mar 16. 10.1038/s41587-020-0455-x PubMed 32393904
