Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

QPM-sgR (pTaU3)
(Plasmid #140448)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 140448 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMOD_C0000
  • Backbone manufacturer
    Daniel Voytas (Addgene plasmid # 91081)
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TaU3-sgRNA
  • gRNA/shRNA sequence
    scaffold: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
  • Species
    Streptococcus pyogene
  • Promoter TaU3

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid may form dimers or multimers. Please see Addgene's Diagnostic Digest for reference. We recommend screening multiple colonies.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    QPM-sgR (pTaU3) was a gift from Caixia Gao (Addgene plasmid # 140448 ; http://n2t.net/addgene:140448 ; RRID:Addgene_140448)
  • For your References section:

    Prime genome editing in rice and wheat. Lin Q, Zong Y, Xue C, Wang S, Jin S, Zhu Z, Wang Y, Anzalone AV, Raguram A, Doman JL, Liu DR, Gao C. Nat Biotechnol. 2020 May;38(5):582-585. doi: 10.1038/s41587-020-0455-x. Epub 2020 Mar 16. 10.1038/s41587-020-0455-x PubMed 32393904