bp::PhiC31
(Plasmid
#140505)
-
PurposeEncodes PhiC31 recombinase downstream of a minimal promoter element
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneStagia3
- Backbone size w/o insert (bp) 5889
- Total vector size (bp) 7728
-
Modifications to backboneGFP was removed from Stagia3 upon digestion with AgeI/BsrgI
-
Vector typeMammalian Expression ; Chicken Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePhiC31
-
Insert Size (bp)1839
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (destroyed during cloning)
- 3′ cloning site BsrgI (not destroyed)
- 5′ sequencing primer GTTCCGCGCACATTTCCCCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPhiC31 from Addgene plasmid #13794
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
bp::PhiC31 was a gift from Mark Emerson (Addgene plasmid # 140505 ; http://n2t.net/addgene:140505 ; RRID:Addgene_140505) -
For your References section:
Lineage tracing analysis of cone photoreceptor associated cis-regulatory elements in the developing chicken retina. Schick E, McCaffery SD, Keblish EE, Thakurdin C, Emerson MM. Sci Rep. 2019 Jun 27;9(1):9358. doi: 10.1038/s41598-019-45750-7. 10.1038/s41598-019-45750-7 PubMed 31249345