Skip to main content

bp::PhiC31
(Plasmid #140505)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140505 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Stagia3
  • Backbone size w/o insert (bp) 5889
  • Total vector size (bp) 7728
  • Modifications to backbone
    GFP was removed from Stagia3 upon digestion with AgeI/BsrgI
  • Vector type
    Mammalian Expression ; Chicken Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PhiC31
  • Insert Size (bp)
    1839

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (destroyed during cloning)
  • 3′ cloning site BsrgI (not destroyed)
  • 5′ sequencing primer GTTCCGCGCACATTTCCCCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PhiC31 from Addgene plasmid #13794

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    bp::PhiC31 was a gift from Mark Emerson (Addgene plasmid # 140505 ; http://n2t.net/addgene:140505 ; RRID:Addgene_140505)
  • For your References section:

    Lineage tracing analysis of cone photoreceptor associated cis-regulatory elements in the developing chicken retina. Schick E, McCaffery SD, Keblish EE, Thakurdin C, Emerson MM. Sci Rep. 2019 Jun 27;9(1):9358. doi: 10.1038/s41598-019-45750-7. 10.1038/s41598-019-45750-7 PubMed 31249345