Skip to main content

CAG::PhiC31
(Plasmid #140506)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140506 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    bp::PhiC31
  • Backbone size w/o insert (bp) 7728
  • Total vector size (bp) 9428
  • Vector type
    Mammalian Expression ; Chicken Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CAG promoter
  • Insert Size (bp)
    1701

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site EcorI (not destroyed)
  • 5′ sequencing primer GTTCCGCGCACATTTCCCCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    CAG from Addgene plasmid #14757

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositor notes that this plasmid contains a ~20bp deletion near the start of the IRES sequence, which may impact IRES function, but was not of concern for this particular study.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG::PhiC31 was a gift from Mark Emerson (Addgene plasmid # 140506 ; http://n2t.net/addgene:140506 ; RRID:Addgene_140506)
  • For your References section:

    Lineage tracing analysis of cone photoreceptor associated cis-regulatory elements in the developing chicken retina. Schick E, McCaffery SD, Keblish EE, Thakurdin C, Emerson MM. Sci Rep. 2019 Jun 27;9(1):9358. doi: 10.1038/s41598-019-45750-7. 10.1038/s41598-019-45750-7 PubMed 31249345