Sender_plasmid1
(Plasmid
#140692)
-
PurposeEncodes constitutive yellow (sfYFP) fluorescence for identification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 2732
- Total vector size (bp) 3445
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfYFP
-
SpeciesSynthetic
-
Insert Size (bp)714
- Promoter pIq constitutive promoter
-
Tag
/ Fusion Protein
- ssrA degradation tag (ASV) (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgttcttcggggcgaaa
- 3′ sequencing primer gccagtgtgagacagcggtgcggac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sender_plasmid1 was a gift from Matthew Bennett (Addgene plasmid # 140692 ; http://n2t.net/addgene:140692 ; RRID:Addgene_140692) -
For your References section:
Spatiotemporal Dynamics of Synthetic Microbial Consortia in Microfluidic Devices. Alnahhas RN, Winkle JJ, Hirning AJ, Karamched B, Ott W, Josic K, Bennett MR. ACS Synth Biol. 2019 Sep 20;8(9):2051-2058. doi: 10.1021/acssynbio.9b00146. Epub 2019 Aug 9. 10.1021/acssynbio.9b00146 PubMed 31361464