Skip to main content

Sender_plasmid2
(Plasmid #140693)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140693 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMB1
  • Backbone size w/o insert (bp) 3257
  • Total vector size (bp) 3860
  • Modifications to backbone
    ROP element reduces copy number
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RhlI
  • Insert Size (bp)
    603
  • Entrez Gene
    rhlI (a.k.a. PA3476)
  • Promoter engineered lac promoter (IPTG inducible)
  • Tag / Fusion Protein
    • ssrA degradation tag (ASV) (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tatggatgcggcgggac
  • 3′ sequencing primer gccagtgtgagacagcggtgcggac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sender_plasmid2 was a gift from Matthew Bennett (Addgene plasmid # 140693 ; http://n2t.net/addgene:140693 ; RRID:Addgene_140693)
  • For your References section:

    Spatiotemporal Dynamics of Synthetic Microbial Consortia in Microfluidic Devices. Alnahhas RN, Winkle JJ, Hirning AJ, Karamched B, Ott W, Josic K, Bennett MR. ACS Synth Biol. 2019 Sep 20;8(9):2051-2058. doi: 10.1021/acssynbio.9b00146. Epub 2019 Aug 9. 10.1021/acssynbio.9b00146 PubMed 31361464