Skip to main content

Receiver_plasmid1
(Plasmid #140694)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140694 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p15A
  • Backbone size w/o insert (bp) 2731
  • Total vector size (bp) 3439
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    708
  • Promoter pIq constitutive promoter
  • Tag / Fusion Protein
    • ssrA degradation tag (ASV) (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgttcttcggggcgaaa
  • 3′ sequencing primer gccagtgtgagacagcggtgcggac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Receiver_plasmid1 was a gift from Matthew Bennett (Addgene plasmid # 140694 ; http://n2t.net/addgene:140694 ; RRID:Addgene_140694)
  • For your References section:

    Spatiotemporal Dynamics of Synthetic Microbial Consortia in Microfluidic Devices. Alnahhas RN, Winkle JJ, Hirning AJ, Karamched B, Ott W, Josic K, Bennett MR. ACS Synth Biol. 2019 Sep 20;8(9):2051-2058. doi: 10.1021/acssynbio.9b00146. Epub 2019 Aug 9. 10.1021/acssynbio.9b00146 PubMed 31361464