pPIC-mouseKir3.2-mC-S
(Plasmid
#140745)
-
PurposeExpression of mouse Kir3.2 fused to mCherry and Streptag II
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPICZ
-
Vector typeYeast Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKir3.2
-
SpeciesM. musculus (mouse)
-
Entrez GeneKcnj6 (a.k.a. BIR1, GIRK2, KATP2, KCNJ7, Kir3.2, weaver, wv)
- Promoter AOX1
-
Tag
/ Fusion Protein
- mCherry with Streptag II (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAAATGGCATTCTGACATCC
- 3′ sequencing primer 3'AOX1 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPIC-mouseKir3.2-mC-S was a gift from Arthur Laganowsky (Addgene plasmid # 140745 ; http://n2t.net/addgene:140745 ; RRID:Addgene_140745) -
For your References section:
Insight into the selectivity of Kir3.2 toward phosphatidylinositides. Qiao P, Liu Y, Zhang T, Benavides A, Laganowsky A. Biochemistry. 2020 May 6. doi: 10.1021/acs.biochem.0c00163. 10.1021/acs.biochem.0c00163 PubMed 32372643