phlFs-mLin
(Plasmid
#140792)
-
PurposeCMV-phlFo-phlFR-2A-mCherry mammalian synthetic gene circuit
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140792 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFRT-Hygromycin
- Total vector size (bp) 7520
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namephlFs-mLinearizer
-
Alt nameCMV-phlFO-PhlFR-2A-mCherry
-
Insert Size (bp)3468
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATCAAGTGTATCATATGCC
- 3′ sequencing primer TGTTTGTCCACCACCGGTAGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phlFs-mLin was a gift from Gabor Balazsi (Addgene plasmid # 140792 ; http://n2t.net/addgene:140792 ; RRID:Addgene_140792) -
For your References section:
Multiplexed Gene Expression Tuning with Orthogonal Synthetic Gene Circuits. Szenk M, Yim T, Balazsi G. ACS Synth Biol. 2020 Apr 17;9(4):930-939. doi: 10.1021/acssynbio.9b00534. Epub 2020 Mar 23. 10.1021/acssynbio.9b00534 PubMed 32167761