pEDJ-22
              
              
                (Plasmid
                
                #140904)
              
            
            
            
          - 
            PurposeMarkerFree plasmid for integration of pADH1-PCP-Mxi1 into site X-4
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCfB3035
- Backbone size w/o insert (bp) 4300
- Total vector size (bp) 5696
- 
              Modifications to backboneADH1 promoter driving PCP-Mxi1 expression was inserted
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert namePCP-Mxi1
- 
                  Insert Size (bp)585
- Promoter ADH1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gaaattcgcttatttagaagtgtc
- 3′ sequencing primer CTCCTTCCTTTTCGGTTAGAG (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pEDJ-22 was a gift from Michael Jensen (Addgene plasmid # 140904 ; http://n2t.net/addgene:140904 ; RRID:Addgene_140904)
- 
                For your References section: Transcriptional reprogramming in yeast using dCas9 and combinatorial gRNA strategies. Jensen ED, Ferreira R, Jakociunas T, Arsovska D, Zhang J, Ding L, Smith JD, David F, Nielsen J, Jensen MK, Keasling JD. Microb Cell Fact. 2017 Mar 15;16(1):46. doi: 10.1186/s12934-017-0664-2. 10.1186/s12934-017-0664-2 PubMed 28298224
