pCAG-AviMta2-3xFiBsd
(Plasmid
#140964)
-
Purposefull-length wt Avi-Mta2-3XFLAG-iBsd cDNA w/CAG promoter and Blasticidin resistance, cloned from mouse ES cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG-A3XFiBsd
-
Backbone manufacturerHendrich Lab
- Backbone size w/o insert (bp) 6348
- Total vector size (bp) 7860
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemetastasis-associated gene family, member 2
-
Alt nameMTA2
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_011842.3
- Promoter CAG
-
Tags
/ Fusion Proteins
- Avi (N terminal on backbone)
- TEV (N terminal on backbone)
- 3xFLAG (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcaacgtgctggttattgtgctg
- 3′ sequencing primer gagaggggcggaattcgatatcaagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-AviMta2-3xFiBsd was a gift from Brian Hendrich (Addgene plasmid # 140964 ; http://n2t.net/addgene:140964 ; RRID:Addgene_140964) -
For your References section:
The Nucleosome Remodelling and Deacetylation complex suppresses transcriptional noise during lineage commitment. Burgold T, Barber M, Kloet S, Cramard J, Gharbi S, Floyd R, Kinoshita M, Ralser M, Vermeulen M, Reynolds N, Dietmann S, Hendrich B. EMBO J. 2019 Jun 17;38(12). pii: embj.2018100788. doi: 10.15252/embj.2018100788. Epub 2019 Apr 29. 10.15252/embj.2018100788 PubMed 31036553