pEMS2155
(Plasmid
#141065)
-
PurposeAAV plasmid with SYN1 promoter driving expression of EmGFP. Contains WPRE.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepEMS2157
-
Backbone manufacturerSimpson lab (deposited at Addgene)
-
Modifications to backboneaddition of SYN1 promoter
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)SURE cells
-
Growth instructions“SURE” cells from Agilent, that the colonies are freshly picked, and the you limit the time to grow the culture. We typically transform the plasmid in the afternoon and take out the plate from the 37 degree incubator in the morning, we then pick the colonies and grow in LB for ~ 20 hrs
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSYN1-EmGFP-WPRE
-
Alt nameHuman Synapsin 1 Promoter - Emerald GFP - Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2625
- Promoter human Synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer oEMS6098 (GCCATGCTCTAGGAAGATCG)
- 3′ sequencing primer oEMS6126 (TCTCAGGCACGACACGACTC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
DNA synthesized at GenScript
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEMS2155 was a gift from Elizabeth Simpson (Addgene plasmid # 141065 ; http://n2t.net/addgene:141065 ; RRID:Addgene_141065) -
For your References section:
Intracerebroventricular Administration of AAV9-PHP.B SYN1-EmGFP Induces Widespread Transgene Expression in the Mouse and Monkey CNS. Galvan A, Petkau TL, Hill AM, Korecki AJ, Lu G, Choi D, Rahman K, Simpson E, Leavitt BR, Smith Y. Hum Gene Ther. 2021 Apr 16. doi: 10.1089/hum.2020.301. 10.1089/hum.2020.301 PubMed 33860682